Security News
RubyGems.org Adds New Maintainer Role
RubyGems.org has added a new "maintainer" role that allows for publishing new versions of gems. This new permission type is aimed at improving security for gem owners and the service overall.
@mmsb/linear-card
Advanced tools
Need two properties : all_sgrna and gene. Others properties are by default but be careful concerning the property width_div.
A string in JSON format, with the sgRNA as key and a list of coordinates as values. This list must match the regex : [+-]\([0-9]*,[0-9]*\) .
{ "AAAGGTACTCCGGGGATAACAGG":["+(3343404,3343426)","+(4024637,4024659)","+(4270051,4270073)","+(4361123,4361145)","+(4466866,4466888)","-(255252,255274)","-(842752,842774)"],
"AACGGATAAAAGGTACTCCGGGG":["+(3343412,3343434)","+(4024645,4024667)","+(4270059,4270081)","+(4361131,4361153)","+(4466874,4466896)","-(255244,255266)","-(842744,842766)"],
"ATGTCGGCTCATCACATCCTGGG":["+(3343334,3343356)","+(4024567,4024589)","+(4269981,4270003)","+(4361053,4361075)","+(4466796,4466818)","-(255322,255344)","-(842822,842844)"],
"ACCTTTTATCCGTTGAGCGATGG":["+(255235,255257)","+(842735,842757)","-(3343421,3343443)","-(4024654,4024676)","-(4270068,4270090)","-(4361140,4361162)","-(4466883,4466905)"]}
A string in JSON format, a list of dictionary with start and end as key and coordinates as values.
[{"start":"255180","end":"255599"},{"start":"842680","end":"843099"},{"start":"3343077","end":"3343496"},{"start":"4024310","end":"4024729"},{"start":"4269724","end":"4270143"},{"start":"4360796","end":"4361215"},{"start":"4466539","end":"4466958"}]
default : 90%
Need a percentage for the width of the bar which represents the gene.
default : 20
The number of bar in histogram.
default : screen.width
If the component is under a div, give the width of the div to calculate the width of the histogram according to the width of the bar.
None
Sophie LEMATRE
July 17 2019
FAQs
Stencil Component Starter
The npm package @mmsb/linear-card receives a total of 0 weekly downloads. As such, @mmsb/linear-card popularity was classified as not popular.
We found that @mmsb/linear-card demonstrated a not healthy version release cadence and project activity because the last version was released a year ago. It has 4 open source maintainers collaborating on the project.
Did you know?
Socket for GitHub automatically highlights issues in each pull request and monitors the health of all your open source dependencies. Discover the contents of your packages and block harmful activity before you install or update your dependencies.
Security News
RubyGems.org has added a new "maintainer" role that allows for publishing new versions of gems. This new permission type is aimed at improving security for gem owners and the service overall.
Security News
Node.js will be enforcing stricter semver-major PR policies a month before major releases to enhance stability and ensure reliable release candidates.
Security News
Research
Socket's threat research team has detected five malicious npm packages targeting Roblox developers, deploying malware to steal credentials and personal data.