@mmsb/result_page

Table of sgRNA with radial representation

Usage

Need property to launch integrated components. So need complete_data to create the table-crispr component to the left side and alL_data, org_names and potentially gene to create genomic-card component.

If the gene property is given, then the linear-card component is created when the user click on a sector on the sunburst.

complete_data

A list of dictionary object in JSON format. Each dictionary has two keys : sequence and occurences. Occurences contains a list of dictionary object with org and all_ref as keys. all_ref contains a list of dictionary object with ref and coords keys which contains a list of coordinates. Coordinate must match the regex : [+-]\([0-9]*,[0-9]*\)

[
    {
        "sequence": "AAAACTCAAATGAATTGACGGGG",
        "occurences": [
            {
                "org": "Buchnera aphidicola (Cinara tujafilina) GCF_000217635.1",
                "all_ref": [
                    {
                        "ref": "NC_015662.1",
                        "coords": [
                            "-(195725,195747)"
                        ]
                    }
                ]
            },
            {
                "org": "Aliivibrio wodanis GCF_000953695.1",
                "all_ref": [
                    {
                        "ref": "NZ_LN554846.1",
                        "coords": [
                            "+(2675080,2675102)",
                            "+(2862314,2862336)",
                            "+(2959996,2960018)",
                            "-(507284,507306)",
                            "-(559657,559679)",
                            "-(661047,661069)"
                        ]
                    },
                    {
                        "ref": "NZ_LN554847.1",
                        "coords": [
                            "+(894485,894507)"
                        ]
                    }
                ]
            }
        ]
    }
]

all_data

A dictionary of organisms selected in JSON format with their referencesn sgRNA on them and their coordinates which must match the regex : [+-]\([0-9]*,[0-9]*\)

{
  "Buchnera aphidicola (Cinara tujafilina) GCF_000217635.1":
  {"NC_015662.1":
    {"AAAACTCAAATGAATTGACGGGG":
      ["-(195725,195747)"],
    "AAACTCAAATGAATTGACGGGGG":
      ["-(195726,195748)"],
    "TCCCCACTGCTGCCTCCCGTAGG":
      ["+(506719,506741)", "+(559092,559114)", "+(660482,660504)", "-(2675645,2675667)", "-(2862879,2862901)", "-(2960561,2960583)"]
    }
  },
  "Aliivibrio wodanis GCF_000953695.1":
    {"NZ_LN554846.1":
      {"AAAACTCAAATGAATTGACGGGG":
        ["+(2675080,2675102)", "+(2862314,2862336)", "+(2959996,2960018)", "-(507284,507306)", "-(559657,559679)", "-(661047,661069)"]
      },
    "NZ_LN554847.1":
      {"AAAACTCAAATGAATTGACGGGG":
        ["+(894485,894507)"]
      }
    }
}

org_names

A string of organisms names selected seperated by "&".

"Enterobacter sp. 638 GCF_000016325.1&Candidatus Blochmannia vafer str. BVAF GCF_000185985.2"

size

If no precise, all size are set to 4,518,734.

{
  "Enterobacter sp. 638 GCF_000016325.1":
    {"NC_009436.1":100000},
  "Candidatus Blochmannia vafer str. BVAF GCF_000185985.2":
    {"NC_014909.2": 2000000}}

gene

A dictionary object with organisms as keys and their references. Then, a list of dictionary with start and end keys to indicate coordinates of gene.

{
  "Enterobacter sp. 638 GCF_000016325.1":
    {"NC_009436.1":
      [{"start": "255180", "end": "255599"}, {"start": "842680", "end": "843099"}, {"start": "3343077", "end": "3343496"}, {"start": "4024310", "end": "4024729"}, {"start": "4269724", "end": "4270143"}, {"start": "4360796", "end": "4361215"}, {"start": "4466539", "end": "4466958"}]
    },
  "Candidatus Blochmannia vafer str. BVAF GCF_000185985.2":
    {"NC_014909.2":
      [{"start": "626246", "end": "626664"}]
    }
}

Event

***** GENOMIC-CARD *****

Emit

• changeOrgCard : sent the name of the organism selected

• changeRefCard : sent the reference selected

• changeSgrnaCard : sent the sgRNA selected

• sgDataSection : sent : allSgrna --> dictionary of sgRNA with their coordinates in a list
  gene --> a list of dictionary containing start and stop for genes

Send

• changeOrgCard : change the organism selected, find data associated to this organism and create a new representation

• changeRefCard : change the reference selected, find data associated and create a new representation

• changeSgrnaCard : represent sgRNA selected by a red vertical line around the circle

• changeOrgRefSgrna : find name of the organism name and its reference in axis key and sgRNA selected in sgrna key. Find data associated and create a new representation

Authors

Sophie LEMATRE

Date

July 22 2019