
Security News
Package Maintainers Call for Improvements to GitHub’s New npm Security Plan
Maintainers back GitHub’s npm security overhaul but raise concerns about CI/CD workflows, enterprise support, and token management.
@mmsb/table-crispr
Advanced tools
Need only one property : complete_data Another component will be installed : radial-crispr to create the radial representation inside table.
You can search a sgRNA by a regex or by a minimun occurence.
A list of dictionary object in JSON format. Each dictionary has two keys : sequence and occurences. Occurences contains a list of dictionary object with org and all_ref as keys. all_ref contains a list of dictionary object with ref and coords keys which contains a list of coordinates. Coordinate must match the regex : [+-]\([0-9]*,[0-9]*\)
[
{
"sequence": "AAAACTCAAATGAATTGACGGGG",
"occurences": [
{
"org": "Buchnera aphidicola (Cinara tujafilina) GCF_000217635.1",
"all_ref": [
{
"ref": "NC_015662.1",
"coords": [
"-(195725,195747)"
]
}
]
},
{
"org": "Aliivibrio wodanis GCF_000953695.1",
"all_ref": [
{
"ref": "NZ_LN554846.1",
"coords": [
"+(2675080,2675102)",
"+(2862314,2862336)",
"+(2959996,2960018)",
"-(507284,507306)",
"-(559657,559679)",
"-(661047,661069)"
]
},
{
"ref": "NZ_LN554847.1",
"coords": [
"+(894485,894507)"
]
}
]
}
]
}
]
None
Sophie LEMATRE
July 18 2019
FAQs
Stencil Component Starter
We found that @mmsb/table-crispr demonstrated a not healthy version release cadence and project activity because the last version was released a year ago. It has 4 open source maintainers collaborating on the project.
Did you know?
Socket for GitHub automatically highlights issues in each pull request and monitors the health of all your open source dependencies. Discover the contents of your packages and block harmful activity before you install or update your dependencies.
Security News
Maintainers back GitHub’s npm security overhaul but raise concerns about CI/CD workflows, enterprise support, and token management.
Product
Socket Firewall is a free tool that blocks malicious packages at install time, giving developers proactive protection against rising supply chain attacks.
Research
Socket uncovers malicious Rust crates impersonating fast_log to steal Solana and Ethereum wallet keys from source code.