
Security News
Opengrep Adds Apex Support and New Rule Controls in Latest Updates
The latest Opengrep releases add Apex scanning, precision rule tuning, and performance gains for open source static code analysis.
Parse sequence files (GenBank, FASTA, SnapGene, SBOL) and accession IDs (NCBI, iGEM) to a common format
Parse sequence files (GenBank, FASTA, JBEI, SnapGene, SBOL) or accession IDs (NCBI, iGEM) to a simple, common format:
interface Seq {
name: string;
type: "dna" | "rna" | "aa" | "unknown";
seq: string;
annotations: Annotation[];
}
interface Annotation {
name: string;
start: number;
end: number;
direction?: number;
color?: string;
type?: string;
}
npm i seqparse
To install the CLI globally:
npm i -g seqparse
import seqparse from "seqparse";
const { name, type, seq, annotations } = await seqparse(file);
Example outputs are truncated for clarity.
# parse files
$ seqparse pBbE0c-RFP.gb
{
"name": "pBbE0c-RFP",
"type": "dna",
"seq": "cagctagctcagtcctaggtactgtgctagctacta...",
"annotations": [
{
"name": "colE1 origin",
"start": 1234,
"end": 1917,
"direction": -1,
"type": "rep_origin"
},
...
# parse files from stdin
$ cat pBbE0c-RFP.fasta | seqparse
{
"name": "pBbE0c-RFP.1",
"type": "dna",
"seq": "cagctagctcagtcctagg...",
"annotations": []
}
# parse files then use jq to get seqs alone
$ seqparse j5.SBOL.xml | jq -r '.seq'
ggcagcaaggtctacggcaaggaacagtttttgcggatgcgccagagcatgttccccgatcgc
# fetch and parse remote sequence files from NCBI
$ seqparse NC_011521
{
"name": "NC_011521",
"type": "dna",
"seq": "cccatcttaagacttcacaagactt...",
"annotations": [
{
"name": "HS566_RS00005",
"start": 6,
"end": 285,
"direction": -1,
"type": "gene"
},
...
FAQs
Parse sequence files (GenBank, FASTA, SnapGene, SBOL) and accession IDs (NCBI, iGEM) to a common format
The npm package seqparse receives a total of 1,088 weekly downloads. As such, seqparse popularity was classified as popular.
We found that seqparse demonstrated a not healthy version release cadence and project activity because the last version was released a year ago. It has 1 open source maintainer collaborating on the project.
Did you know?
Socket for GitHub automatically highlights issues in each pull request and monitors the health of all your open source dependencies. Discover the contents of your packages and block harmful activity before you install or update your dependencies.
Security News
The latest Opengrep releases add Apex scanning, precision rule tuning, and performance gains for open source static code analysis.
Security News
npm now supports Trusted Publishing with OIDC, enabling secure package publishing directly from CI/CD workflows without relying on long-lived tokens.
Research
/Security News
A RubyGems malware campaign used 60 malicious packages posing as automation tools to steal credentials from social media and marketing tool users.