diced - npm Package Compare versions

Comparing version 0.1.0 to 0.1.1

CHANGELOG.md

@@ -9,5 +9,17 @@ # Changelog
 ## [Unreleased]
-[Unreleased]: https://github.com/althonos/diced/compare/v0.1.0...HEAD
+[Unreleased]: https://github.com/althonos/diced/compare/v0.1.1...HEAD
 
 
+## [v0.1.1] - 2024-06-19
+[v0.1.1]: https://github.com/althonos/diced/compare/v0.1.0...v0.1.1
+
+### Changed
+- Use raw sequence bytes to avoid panics on Unicode characters slicing in `Scanner`.
+
+### Fixed
+- Incorrect metadata in Python package and documentation.
+- Missing test data in Python wheels.
+- Indexing and underflow errors found by `afl` fuzzer.
+
+
 ## [v0.1.0] - 2024-06-11
@@ -14,0 +26,0 @@ [Unreleased]: https://github.com/althonos/diced/compare/11ad0d3...v0.1.0

diced-py/Cargo.toml

 [package]
 name = "diced-py"
-version = "0.1.0"
+version = "0.1.1"
 authors = ["Martin Larralde <[e-mail]>"]
@@ -21,3 +21,3 @@ edition = "2021"
 path = "../diced"
-version = "0.1.0"
+version = "0.1.1"
 
@@ -24,0 +24,0 @@ [dependencies]

diced-py/diced.egg-info/PKG-INFO

 Metadata-Version: 2.1
 Name: diced
-Version: 0.1.0
+Version: 0.1.1
 Summary: Rust re-implementation of the MinCED algorithm to Detect Instances of CRISPRs in Environmental Data.
@@ -8,3 +8,3 @@ Home-page: https://github.com/althonos/diced
 Author-email: [e-mail]
-License: MIT OR GPL-3.0-or-later
+License: GPL-3.0-or-later
 Project-URL: Bug Tracker, https://github.com/althonos/diced/issues
@@ -20,3 +20,3 @@ Project-URL: Changelog, https://github.com/althonos/diced/blob/master/CHANGELOG.md
 Classifier: Intended Audience :: Science/Research
-Classifier: License :: OSI Approved :: MIT License
+Classifier: License :: OSI Approved :: GNU General Public License v3 or later (GPLv3+)
 Classifier: Operating System :: OS Independent
@@ -44,3 +44,3 @@ Classifier: Programming Language :: Rust
 
-[![Actions](https://img.shields.io/github/actions/workflow/status/althonos/diced/test.yml?branch=main&logo=github&style=flat-square&maxAge=300)](https://github.com/althonos/diced/actions)
+[![Actions](https://img.shields.io/github/actions/workflow/status/althonos/diced/python.yml?branch=main&logo=github&style=flat-square&maxAge=300)](https://github.com/althonos/diced/actions)
 [![Coverage](https://img.shields.io/codecov/c/gh/althonos/diced?style=flat-square&maxAge=3600&logo=codecov)](https://codecov.io/gh/althonos/diced/)
@@ -74,2 +74,4 @@ [![License](https://img.shields.io/badge/license-GPLv3-blue.svg?style=flat-square&maxAge=2678400)](https://choosealicense.com/licenses/gpl-3.0/)
 
+*This is the Python version, there is a [Rust crate](https://crates.io/crates/diced) available as well.*
+
 ### 📋 Features
@@ -76,0 +78,0 @@

diced-py/diced/__init__.py

@@ -1,2 +0,2 @@
-__version__ = "0.1.0"
+__version__ = "0.1.1"
 
@@ -3,0 +3,0 @@ from . import lib

diced-py/README.md

@@ -5,3 +5,3 @@ # 🔪🧅 Diced [![Star me](https://img.shields.io/github/stars/althonos/mincer?style=social&label=Star&maxAge=3600)](https://github.com/althonos/diced/stargazers)
 
-[![Actions](https://img.shields.io/github/actions/workflow/status/althonos/diced/test.yml?branch=main&logo=github&style=flat-square&maxAge=300)](https://github.com/althonos/diced/actions)
+[![Actions](https://img.shields.io/github/actions/workflow/status/althonos/diced/python.yml?branch=main&logo=github&style=flat-square&maxAge=300)](https://github.com/althonos/diced/actions)
 [![Coverage](https://img.shields.io/codecov/c/gh/althonos/diced?style=flat-square&maxAge=3600&logo=codecov)](https://codecov.io/gh/althonos/diced/)
@@ -35,2 +35,4 @@ [![License](https://img.shields.io/badge/license-GPLv3-blue.svg?style=flat-square&maxAge=2678400)](https://choosealicense.com/licenses/gpl-3.0/)
 
+*This is the Python version, there is a [Rust crate](https://crates.io/crates/diced) available as well.*
+
 ### 📋 Features
@@ -37,0 +39,0 @@

diced/Cargo.toml

 [package]
 name = "diced"
-version = "0.1.0"
+version = "0.1.1"
 authors = ["Martin Larralde <[e-mail]>"]
@@ -5,0 +5,0 @@ edition = "2021"

diced/README.md

@@ -5,3 +5,3 @@ # 🔪🧅 Diced [![Star me](https://img.shields.io/github/stars/althonos/mincer?style=social&label=Star&maxAge=3600)](https://github.com/althonos/diced/stargazers)
 
-[![Actions](https://img.shields.io/github/actions/workflow/status/althonos/diced/test.yml?branch=main&logo=github&style=flat-square&maxAge=300)](https://github.com/althonos/diced/actions)
+[![Actions](https://img.shields.io/github/actions/workflow/status/althonos/diced/rust.yml?branch=main&logo=github&style=flat-square&maxAge=300)](https://github.com/althonos/diced/actions)
 [![Coverage](https://img.shields.io/codecov/c/gh/althonos/diced?logo=codecov&style=flat-square&maxAge=3600)](https://codecov.io/gh/althonos/diced/)
@@ -31,2 +31,4 @@ [![License](https://img.shields.io/badge/license-GPLv3-blue.svg?style=flat-square&maxAge=2678400)](https://choosealicense.com/licenses/gpl-3.0/)
 
+*This is the Rust version, there is a [Python package](https://pypi.org/project/diced) available as well.*
+
 ### 📋 Features
@@ -33,0 +35,0 @@

diced/src/lib.rs

@@ -67,3 +67,3 @@ #![doc = include_str!("../README.md")]
     pub fn new(sequence: S) -> Self {
-        let s = sequence.as_ref();
+        let s = sequence.as_ref().as_bytes();
         let mut mask = Vec::new();
@@ -79,3 +79,3 @@
 
-            while j < s.len() && s.as_bytes()[i] == s.as_bytes()[j] {
+            while j < s.len() && s[i] == s[j] {
                 n += 1;
@@ -243,4 +243,5 @@ j += 1;
 
-    fn _scan_right(&self, crispr: &mut Crispr<S>, pattern: &str, scan_range: usize) {
+    fn _scan_right(&self, crispr: &mut Crispr<S>, pattern: &[u8], scan_range: usize) {
         let seq = crispr.sequence.as_ref();
+        let bytes = seq.as_bytes();
 
@@ -275,6 +276,6 @@ let num_repeats = crispr.indices.len();
 
-            let subseq = &seq[begin_search..end_search];
+            let subseq = &bytes[begin_search..end_search];
 
             #[cfg(feature = "memchr")]
-            let pos = finder.find(subseq.as_bytes());
+            let pos = finder.find(subseq);
             #[cfg(not(feature = "memchr"))]
@@ -314,3 +315,3 @@ let pos = subseq.find(pattern);
         let max_right_extension_length =
-            shortest_repeat_spacing - self.parameters.min_spacer_length;
+            shortest_repeat_spacing.saturating_sub(self.parameters.min_spacer_length);
 
@@ -339,8 +340,11 @@ while right_extension_length <= max_right_extension_length {
         }
-        right_extension_length -= 1;
+        if right_extension_length > 0 {
+            right_extension_length -= 1;
+        }
         char_counts.clear();
 
         let mut left_extension_length = 0;
-        let max_left_extension_length =
-            shortest_repeat_spacing - self.parameters.min_spacer_length - right_extension_length;
+        let max_left_extension_length = shortest_repeat_spacing
+            .saturating_sub(self.parameters.min_spacer_length)
+            .saturating_sub(right_extension_length);
         while left_extension_length <= max_left_extension_length {
@@ -367,3 +371,5 @@ if first_repeat_start_index < left_extension_length {
         }
-        left_extension_length -= 1;
+        if left_extension_length > 0 {
+            left_extension_length -= 1;
+        }
 
@@ -559,4 +565,4 @@ for index in crispr.indices.iter_mut() {
                 let repeat = crispr.repeat(k);
-                let first_char = repeat.chars().next().unwrap();
-                char_counts.count(first_char);
+                let first_char = repeat.as_bytes().first().unwrap();
+                char_counts.count(*first_char as char);
             }
@@ -580,2 +586,3 @@ if (char_counts.max() as f32) / (num_repeats as f32) < Self::THRESHOLD {
         let seq = self.sequence.as_ref();
+        let bytes = seq.as_bytes();
 
@@ -625,7 +632,7 @@ let skips = self
 
-            let pattern = &seq[pattern_start..pattern_end];
-            let subseq = &seq[begin_search..end_search];
+            let pattern = &bytes[pattern_start..pattern_end];
+            let subseq = &bytes[begin_search..end_search];
 
             #[cfg(feature = "memchr")]
-            let pos = memchr::memmem::find(subseq.as_bytes(), pattern.as_bytes());
+            let pos = memchr::memmem::find(subseq, pattern);
             #[cfg(not(feature = "memchr"))]
@@ -831,2 +838,43 @@ let pos = subseq.find(pattern);
     }
+
+    #[test]
+    fn scan_unicode() {
+        const UNICODE: &'static str = concat!(
+            "AAAAAAAGAFCACATTGACGCGGGGGGGGCATACCAAACATAATTGACcCGGACACGCCAAGGCT",
+            "CACGTTAACAAAAGACACGACGCGGGACAATAGGATAAACATAATTGACTAAACGTGGGAACACG",
+            "CGGGCATACCAAACATAATTGACcCGGATTGACGCGGGACAATAGGATAAACATAATTGACCACC",
+            "CGGACACCAAAAAAAGAFCACATTGACGCGGGCATACCAgACATAαTTGACcCGGAAAAAAAAGA",
+            "FCACATTGACGAAAAAGA)GAFCACATSGACGGTCGTTTTCATGAACAAGTTGACcCGGACdCAA",
+            "CAAAGAFCACATTGACGCGGcCGGACdCAACAAAGGCATACCAAACATAAATTGGCGGGCATACC",
+            "AAACA"
+        );
+
+        let it = ScannerBuilder::default().scan(UNICODE);
+        let crisprs = it.collect::<Vec<_>>();
+        assert_eq!(crisprs.len(), 0);
+
+        const UNICODE2: &'static str = concat!(
+            "GAAJJJJGssGAGAGGTATAACCAbAACCGTTGTGTJJJJJJJJJJJJJJJJJJJGGTATAACCA",
+            "bAACCGTTGTGT@AGGAGAGGTATAACCAbAACCGTTGTGT@GGTJJJJJJGGTATAACCAbAAC",
+            "CGTATAAGAGGTATAACCAbAACCGTTGTGT@GGTATAGATCTAATGG?AATGAAGGCAATAAGG",
+            "T\x04\x00yN",
+        );
+
+        let it2 = ScannerBuilder::default().scan(UNICODE2);
+        let crisprs2 = it2.collect::<Vec<_>>();
+        assert_eq!(crisprs2.len(), 0);
+
+        const UNICODE3: &'static str = concat!(
+            "GAAJJJJJJJJJJJJJJJJJJJJJJJGGTATAACCAbAACCGTTGTGT@AGGAGAGGTATAACCAbAACC",
+            "GTTGTGT@GGTJJJJJJGGTATAACCAbAACCGTATAAGAGGTATAACCAAGAGGTATAACCAbAACCGT",
+            "TGTGGAAJJJJJJJJJJJJJJJJJCCGTTGTTGTGT@AGGAGAGGTATAACCAbAACCGTTGTGT@GGTJ",
+            "JJJJJGGTETAACCAbAACCGTATAAGAGGTATAACCAbAACCGAGAGGTAGGACAACTTACCTACATAA",
+            "CCAbAACCGTTGTGGAAJJJJJJJJJJJJJJJJJCCGTTGTTGTGT@AGGAGAGGTATAACCAbAACCGT",
+            "TGTGT@GAAJJJJJJJJJJJJJJJJJJJJJJJGGTATAA6CAbAACAGTTGTGT@AGGAGAGGTATAACC",
+            "AbAACCGTTGTGT@GGTJJJJJJGGTATAACCAGCGGTTGAAGGTGTGCAACCTCAGTCbAACCGTACGT",
+        );
+        let it3 = ScannerBuilder::default().scan(UNICODE3);
+        let crisprs3 = it3.collect::<Vec<_>>();
+        assert_eq!(crisprs3.len(), 1);
+    }
 }

PKG-INFO

 Metadata-Version: 2.1
 Name: diced
-Version: 0.1.0
+Version: 0.1.1
 Summary: Rust re-implementation of the MinCED algorithm to Detect Instances of CRISPRs in Environmental Data.
@@ -8,3 +8,3 @@ Home-page: https://github.com/althonos/diced
 Author-email: [e-mail]
-License: MIT OR GPL-3.0-or-later
+License: GPL-3.0-or-later
 Project-URL: Bug Tracker, https://github.com/althonos/diced/issues
@@ -20,3 +20,3 @@ Project-URL: Changelog, https://github.com/althonos/diced/blob/master/CHANGELOG.md
 Classifier: Intended Audience :: Science/Research
-Classifier: License :: OSI Approved :: MIT License
+Classifier: License :: OSI Approved :: GNU General Public License v3 or later (GPLv3+)
 Classifier: Operating System :: OS Independent
@@ -44,3 +44,3 @@ Classifier: Programming Language :: Rust
 
-[![Actions](https://img.shields.io/github/actions/workflow/status/althonos/diced/test.yml?branch=main&logo=github&style=flat-square&maxAge=300)](https://github.com/althonos/diced/actions)
+[![Actions](https://img.shields.io/github/actions/workflow/status/althonos/diced/python.yml?branch=main&logo=github&style=flat-square&maxAge=300)](https://github.com/althonos/diced/actions)
 [![Coverage](https://img.shields.io/codecov/c/gh/althonos/diced?style=flat-square&maxAge=3600&logo=codecov)](https://codecov.io/gh/althonos/diced/)
@@ -74,2 +74,4 @@ [![License](https://img.shields.io/badge/license-GPLv3-blue.svg?style=flat-square&maxAge=2678400)](https://choosealicense.com/licenses/gpl-3.0/)
 
+*This is the Python version, there is a [Rust crate](https://crates.io/crates/diced) available as well.*
+
 ### 📋 Features
@@ -76,0 +78,0 @@

README.md

@@ -5,3 +5,3 @@ # 🔪🧅 Diced [![Star me](https://img.shields.io/github/stars/althonos/mincer?style=social&label=Star&maxAge=3600)](https://github.com/althonos/diced/stargazers)
 
-[![Actions](https://img.shields.io/github/actions/workflow/status/althonos/diced/test.yml?branch=main&logo=github&style=flat-square&maxAge=300)](https://github.com/althonos/diced/actions)
+[![Actions](https://img.shields.io/github/actions/workflow/status/althonos/diced/rust.yml?branch=main&logo=github&style=flat-square&maxAge=300)](https://github.com/althonos/diced/actions)
 [![Coverage](https://img.shields.io/codecov/c/gh/althonos/diced?logo=codecov&style=flat-square&maxAge=3600)](https://codecov.io/gh/althonos/diced/)
@@ -31,2 +31,4 @@ [![License](https://img.shields.io/badge/license-GPLv3-blue.svg?style=flat-square&maxAge=2678400)](https://choosealicense.com/licenses/gpl-3.0/)
 
+*This is the Rust version, there is a [Python package](https://pypi.org/project/diced) available as well.*
+
 ### 📋 Features
@@ -33,0 +35,0 @@

setup.cfg

@@ -10,3 +10,3 @@ [metadata]
 long_description_content_type = text/markdown
-license = MIT OR GPL-3.0-or-later
+license = GPL-3.0-or-later
 platform = any
@@ -18,3 +18,3 @@ keywords = bioinformatics, genomics, motif, pssm, matrix
 	Intended Audience :: Science/Research
-	License :: OSI Approved :: MIT License
+	License :: OSI Approved :: GNU General Public License v3 or later (GPLv3+)
 	Operating System :: OS Independent
@@ -63,2 +63,4 @@ Programming Language :: Rust
 	requirements.txt
+diced.tests.data = 
+	*.fna
 
@@ -65,0 +67,0 @@ [bdist_wheel]

Alert delta unavailable

Currently unable to show alert delta for PyPI packages.

Improved metrics

Total package byte prevSize

1711956

0.19%