rereferencer

Primer Extractor

A tool for extracting amplified regions from reference sequences using primer pairs.

Installation

pip install rereferencer

Usage

The tool can be used to extract amplified regions from reference sequences using primer pairs. It supports:

• FASTA reference sequences
• GFF/GTF annotation files
• Primer pairs in CSV format
• Progress bars for long-running operations
• Rich table output for results

Command Line Interface

Usage: rereferencer [OPTIONS]

Options:
  --primer-file PATH     CSV file containing primer pairs (name, forward, reverse) [required]
  --reference PATH       Reference sequence file in FASTA format [required]
  --output PATH          Output file for amplified regions in FASTA format [required]
  --remove-primers       Remove primer sequences from the output
  --forward-tail TEXT    5' tail sequence (5'-3' direction) to remove from forward primers
  --reverse-tail TEXT    5' tail sequence (5'-3' direction) to remove from reverse primers
  --gff PATH            GFF/GTF file for gene annotations
  --ref-gene TEXT       Reference gene name for re-referencing sequences
  --window-size INTEGER Window size for re-referencing (default: 1000)
  --help                Show this message and exit.

Examples

# Basic usage with progress bar
rereferencer \
    --primer-file example_primers.csv \
    --reference references/Mycobacterium_tuberculosis_H37Rv_genome_v4.fasta \
    --output mtb_amplicons.fasta

# Using GFF annotations and re-referencing to a specific gene
rereferencer \
    --primer-file example_primers.csv \
    --reference references/Mycobacterium_tuberculosis_H37Rv_genome_v4.fasta \
    --gff references/Mycobacterium_tuberculosis_H37Rv_gff_v4.gff \
    --ref-gene rpoB \
    --window-size 1000 \
    --output mtb_amplicons_rpoB.fasta

# Remove primer sequences and tails from output
rereferencer \
    --primer-file example_primers.csv \
    --reference references/Mycobacterium_tuberculosis_H37Rv_genome_v4.fasta \
    --remove-primers \
    --forward-tail ACGTACGT \
    --reverse-tail TGCATGCA \
    --output mtb_amplicons_no_primers.fasta

Input Files

• Primer File (CSV)

  • Must contain columns: name, forward, reverse
  • Example:

  name,forward,reverse
  rpoB_RRDR,GGGAGCGGATGACCACCC,GCGGTACGGCGTTTCGATGAAC
  katG_315,GCTGATCCACCGCGGCATC,GCCGAGTCGTTCATCGTGCT
  

• Reference Sequence (FASTA)

  • Standard FASTA format
  • Can be single or multi-sequence
  • Supports compressed files (.gz, .bz2)

• GFF/GTF File (Optional)

  • Standard GFF/GTF format
  • Used for gene annotations and re-referencing
  • Supports compressed files (.gz, .bz2)

Output

The tool generates:

• A FASTA file containing the extracted regions
• A progress bar showing the processing status
• A summary table showing the number of matches found for each primer pair
• Detailed logging of the extraction process

Features

• Progress Tracking: Shows progress bars for long-running operations
• Rich Output: Uses rich tables for clear result presentation
• Flexible Matching: Supports strict 5' end matching
• Gene Annotation: Integrates with GFF/GTF files for gene context
• Re-referencing: Can re-reference sequences to specific genes
• Primer Removal: Option to remove primer sequences from output
• Compressed File Support: Handles gzipped and bzipped input files
• Detailed Logging: Comprehensive logging of the extraction process

Requirements

• Python 3.8+
• click
• biopython
• pandas
• rich

Author

• Name: SemiQuant
• Email: [e-mail]
• GitHub: SemiQuant

License

This project is licensed under the MIT License - see the LICENSE file for details.