Launch Week Day 2: Introducing Reports: An Extensible Reporting Framework for Socket Data.Learn More
Socket
Book a DemoSign in
Socket

@teselagen/bio-parsers

Package Overview
Dependencies
Maintainers
5
Versions
77
Alerts
File Explorer

Advanced tools

Socket logo

Install Socket

Detect and block malicious and high-risk dependencies

Install

@teselagen/bio-parsers

<!-- TOC -->

latest
Source
npmnpm
Version
0.4.37
Version published
Weekly downloads
6.3K
-23.76%
Maintainers
5
Weekly downloads
 
Created
Source

Bio Parsers

About this Repo

This repo contains a set of parsers to convert between datatypes through a generalized JSON format.

CHANGELOG

Exported Functions

Use the following exports to convert to a generalized JSON format:

fastaToJson //handles fasta files (.fa, .fasta)
genbankToJson //handles genbank files (.gb, .gbk)
ab1ToJson //handles .ab1 sequencing read files
sbolXmlToJson //handles .sbol files
geneiousXmlToJson //handles .genious files
jbeiXmlToJson //handles jbei .seq or .xml files
snapgeneToJson //handles snapgene (.dna) files
anyToJson    //this handles any of the above file types based on file extension

Use the following exports to convert from a generalized JSON format back to a specific format:

jsonToGenbank
jsonToFasta
jsonToBed

Format Specification

The generalized JSON format looks like:

const generalizedJsonFormat = {
  size: 25,
  sequence: "asaasdgasdgasdgasdgasgdasgdasdgasdgasgdagasdgasdfasdfdfasdfa",
  circular: true,
  name: "pBbS8c-RFP",
  description: "",
  parts: [
    {
      name: "part 1",
      type: "CDS", //optional for parts
      id: "092j92", //Must be a unique id. If no id is provided, we'll autogenerate one for you
      start: 10, //0-based inclusive index
      end: 30, //0-based inclusive index
      strand: 1,
      notes: {}
    }
  ],
  primers: [
    {
      name: "primer 1",
      id: "092j92", //Must be a unique id. If no id is provided, we'll autogenerate one for you
      start: 10, //0-based inclusive index
      end: 30, //0-based inclusive index
      strand: 1,
      notes: {}
    }
  ],
  features: [
    {
      name: "anonymous feature",
      type: "misc_feature",
      id: "5590c1978979df000a4f02c7", //Must be a unique id. If no id is provided, we'll autogenerate one for you
      start: 1,
      end: 3,
      strand: 1,
      notes: {}
    },
    {
      name: "coding region 1",
      type: "CDS",
      id: "5590c1d88979df000a4f02f5",
      start: 12,
      end: 9,
      strand: -1,
      notes: {}
    }
  ],
  //only if parsing in an ab1 file
  chromatogramData: {
    aTrace: [], //same as cTrace but for a
    tTrace: [], //same as cTrace but for t
    gTrace: [], //same as cTrace but for g
    cTrace: [0, 0, 0, 1, 3, 5, 11, 24, 56, 68, 54, 30, 21, 3, 1, 4, 1, 0, 0, ...etc], //heights of the curve spaced 1 per x position (aka if the cTrace.length === 1000, then the max basePos can be is 1000)
    basePos: [33, 46, 55, ...etc], //x position of the bases (can be unevenly spaced)
    baseCalls: ["A", "T", ...etc],
    qualNums: [] //or undefined if no qualNums are detected on the file
  }
};

Usage

install

npm install -S @teselagen/bio-parsers

or

yarn add @teselagen/bio-parsers

or

use it from a script tag:

<script src="https://unpkg.com/bio-parsers/umd/bio-parsers.js"></script>
<script>
  async function main() {
    var jsonOutput = await window.bioParsers.genbankToJson(
      `LOCUS       kc2         108 bp    DNA     linear    01-NOV-2016
COMMENT             teselagen_unique_id: 581929a7bc6d3e00ac7394e8
FEATURES             Location/Qualifiers
     CDS             1..108
                     /label="GFPuv"
     misc_feature    61..108
                     /label="gly_ser_linker"
     bogus_dude      4..60
                     /label="ccmN_sig_pep"
     misc_feature    4..60
                     /label="ccmN_nterm_sig_pep"
                     /pragma="Teselagen_Part"
                     /preferred5PrimeOverhangs=""
                     /preferred3PrimeOverhangs=""
ORIGIN      
        1 atgaaggtct acggcaagga acagtttttg cggatgcgcc agagcatgtt ccccgatcgc
       61 ggtggcagtg gtagcgggag ctcgggtggc tcaggctctg ggg
//`
    );
    console.log("jsonOutput:", jsonOutput);
    var genbankString = window.bioParsers.jsonToGenbank(jsonOutput[0].parsedSequence);
    console.log(genbankString);
  }
  main();
</script>

see the ./umd_demo.html file for a full working example

jsonToGenbank (same interface as jsonToFasta)

//To go from json to genbank:
import { jsonToGenbank } from "bio-parsers"
//You can pass an optional options object as the second argument. Here are the defaults
const options = {
  isProtein: false, //by default the sequence will be parsed and validated as type DNA (unless U's instead of T's are found). If isProtein=true the sequence will be parsed and validated as a PROTEIN type (seqData.isProtein === true)
  guessIfProtein: false, //if true the parser will attempt to guess if the sequence is of type DNA or type PROTEIN (this will override the isProtein flag)
  guessIfProteinOptions: {
    threshold = 0.90, //percent of characters that must be DNA letters to be considered of type DNA
    dnaLetters = ['G', 'A', 'T', 'C'] //customizable set of letters to use as DNA
  },
  inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive
  inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive
  // Example:
  // 0123456
  // ATGAGAG
  // --fff--  (the feature covers GAG)
  // 0-based inclusive start:
  // feature.start = 2
  // 1-based inclusive start:
  // feature.start = 3
  // 0-based inclusive end:
  // feature.end = 4
  // 1-based inclusive end:
  // feature.end = 5
}
const genbankString = jsonToGenbank(generalizedJsonFormat, options)

anyToJson (same interface as genbankToJson, fastaToJson, xxxxToJson) (async required)

import { anyToJson } from "bio-parsers";

//note, anyToJson should be called using an await to allow for file parsing to occur (if a file is being passed)
const results = await anyToJson(
  stringOrFile, //if ab1 files are being passed in you should pass files only, otherwise strings or files are fine as inputs
  options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to!
);

//we always return an array of results because some files my contain multiple sequences
results[0].success; //either true or false
results[0].messages; //either an array of strings giving any warnings or errors generated during the parsing process
results[0].parsedSequence; //this will be the generalized json format as specified above :)
//chromatogram data will be here (ab1 only):
results[0].parsedSequence.chromatogramData;

Options (for anyToJson or xxxxToJson)

//You can pass an optional options object as the third argument. Here are the defaults
const options = {
  fileName: "example.gb", //the filename is used if none is found in the genbank
  isProtein: false, //if you know that it is a protein string being parsed you can pass true here
  parseFastaAsCircular: false; //by default fasta files are parsed as linear sequences. You can change this by setting parseFastaAsCircular=true
  //genbankToJson options only
  inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive
  inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive
  acceptParts: true //by default features with a feature.notes.pragma[0] === "Teselagen_Part" are added to the sequenceData.parts array. Setting this to false will keep them as features instead
  // fastaToJson options only
  parseName: true //by default attempt to parse the name and description of sequence from the comment line. Setting this to false will keep the name unchanged with no description
}

ab1ToJson

import { ab1ToJson } from "bio-parsers";
const results = await ab1ToJson(
  //this can be either a browser file  <input type="file" id="input" multiple onchange="ab1ToJson(this.files[0])">
  // or a node file ab1ToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1')));
  file,
  options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to!
);

//we always return an array of results because some files my contain multiple sequences
results[0].success; //either true or false
results[0].messages; //either an array of strings giving any warnings or errors generated during the parsing process
results[0].parsedSequence; //this will be the generalized json format as specified above :)
//chromatogram data will be here (ab1 only):
results[0].parsedSequence.chromatogramData;

snapgeneToJson (.dna files)

import { snapgeneToJson } from "bio-parsers";
//file can be either a browser file  <input type="file" id="input" multiple onchange="snapgeneToJson(this.files[0])">
// or a node file snapgeneToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1')));
const results = await snapgeneToJson(file, options);

genbankToJson

import { genbankToJson } from "bio-parsers";

const result = genbankToJson(string, options);

console.info(result);
// [
//     {
//         "messages": [
//             "Import Error: Illegal character(s) detected and removed from sequence. Allowed characters are: atgcyrswkmbvdhn",
//             "Invalid feature end:  1384 detected for Homo sapiens and set to 1",
//         ],
//         "success": true,
//         "parsedSequence": {
//             "features": [
//                 {
//                     "notes": {
//                         "organism": [
//                             "Homo sapiens"
//                         ],
//                         "db_xref": [
//                             "taxon:9606"
//                         ],
//                         "chromosome": [
//                             "17"
//                         ],
//                         "map": [
//                             "17q21"
//                         ]
//                     },
//                     "type": "source",
//                     "strand": 1,
//                     "name": "Homo sapiens",
//                     "start": 0,
//                     "end": 1
//                 }
//             ],
//             "name": "NP_003623",
//             "sequence": "gagaggggggttatccccccttcgtcagtcgatcgtaacgtatcagcagcgcgcgagattttctggcgcagtcag",
//             "circular": true,
//             "extraLines": [
//                 "DEFINITION  contactin-associated protein 1 precursor [Homo sapiens].",
//                 "ACCESSION   NP_003623",
//                 "VERSION     NP_003623.1  GI:4505463",
//                 "DBSOURCE    REFSEQ: accession NM_003632.2",
//                 "KEYWORDS    RefSeq."
//             ],
//             "type": "DNA",
//             "size": 925
//         }
//     }
// ]

You can see more examples by looking at the tests.

Updating this repo

Outside collaborators

fork and pull request please :)

Thanks/Collaborators

FAQs

Package last updated on 16 Apr 2026

Did you know?

Socket

Socket for GitHub automatically highlights issues in each pull request and monitors the health of all your open source dependencies. Discover the contents of your packages and block harmful activity before you install or update your dependencies.

Install

Related posts