Security News
Opengrep Emerges as Open Source Alternative Amid Semgrep Licensing Controversy
Opengrep forks Semgrep to preserve open source SAST in response to controversial licensing changes.
Python bindings to DustMasker, a utility to identify and mask low-complexity regions in nucleotide sequences
pydustmasker
is a Python library that provides an efficient implementation of the SDUST algorithm1, designed to identify and mask low-complexity regions in nucleotide sequences.
pydustmasker
provides a DustMasker
class that enables identification of low-complexity regions in an input DNA sequence and mask these regions.
Here is a basic example of how to use pydustmasker
:
import pydustmasker
# Example nucleotide sequence
masker = pydustmasker.DustMasker("CGTATATATATAGTATGCGTACTGGGGGGGCT")
# Get the low-complexity regions in the sequence and the number of masked bases
>>> print(masker.intervals)
[(23, 30)]
>>> print(masker.n_masked_bases)
7
# The mask() method returns the sequence with low-complexity regions soft-masked
>>> print(masker.mask())
CGTATATATATAGTATGCGTACTgggggggCT
# Hard-masking can be enabled by setting the `hard` parameter to `True`
>>> print(masker.mask(hard=True))
CGTATATATATAGTATGCGTACTNNNNNNNCT
# The `window_size` and `score_threshold` parameters can be adjusted to tune the masking
>>> masker = pydustmasker.DustMasker(
... "CGTATATATATAGTATGCGTACTGGGGGGGCT",
... score_threshold=10
... )
>>> print(masker.intervals)
[(2, 12), (23, 30)]
>>> print(masker.mask())
CGtatatatataGTATGCGTACTgggggggCT
Morgulis, Aleksandr, et al. "A fast and symmetric DUST implementation to mask low-complexity DNA sequences". Journal of Computational Biology 13.5 (2006): 1028-1040. ↩
FAQs
Python bindings to DustMasker, a utility to identify and mask low-complexity regions in nucleotide sequences
We found that pydustmasker demonstrated a healthy version release cadence and project activity because the last version was released less than a year ago. It has 1 open source maintainer collaborating on the project.
Did you know?
Socket for GitHub automatically highlights issues in each pull request and monitors the health of all your open source dependencies. Discover the contents of your packages and block harmful activity before you install or update your dependencies.
Security News
Opengrep forks Semgrep to preserve open source SAST in response to controversial licensing changes.
Security News
Critics call the Node.js EOL CVE a misuse of the system, sparking debate over CVE standards and the growing noise in vulnerability databases.
Security News
cURL and Go security teams are publicly rejecting CVSS as flawed for assessing vulnerabilities and are calling for more accurate, context-aware approaches.