bionode-ncbi - npm Package Compare versions

Comparing version 1.6.0 to 1.6.1

cli.js

 #!/usr/bin/env node
 var minimist = require('minimist')
 var JSONStream = require('JSONStream')
-var split = require('split')
+var split = require('split2')
 var ncbi = require('./')
@@ -15,4 +15,15 @@
 
-var argv = minimist(process.argv.slice(2), minimistOptions)
+var jsonPattern = /\{(.+?)\}/,
+  args = process.argv.slice(2).join(' '),
+  options = {},
+  match = args.match(jsonPattern)
 
+if (match) {
+  var jsonLine = match[0].replace(/\'/g, '\"'),
+    options = JSON.parse(jsonLine),
+    args = args.replace(match[0], 'obj')
+}
+
+var argv = minimist(args.split(' '), minimistOptions)
+
 if (argv.help || argv._.length === 0) {
@@ -40,13 +51,13 @@ console.log('Please check the documentation at http://doc.bionode.io')
 
-var options
 if (Object.keys(argv).length > 1) {
-  options = {
-    limit: argv.limit,
-    throughput: argv.throughput,
-    db: arg1,
-    term: arg2
+  options.limit = argv.limit
+  options.throughput = argv.throughput
+
+  if (arg1 !== 'obj') {
+    options.db = arg1
+    options.term = arg2
   }
 }
 
-var ncbiStream = options ? ncbi[command](options) : ncbi[command](arg1, arg2, arg3)
+var ncbiStream = Object.keys(options).length ? ncbi[command](options) : ncbi[command](arg1, arg2, arg3)
 
@@ -62,2 +73,5 @@ ncbiStream.pipe(JSONStream.stringify(false)).pipe(process.stdout)
   })
+  process.stdin.on('end', function () {
+    ncbiStream.end()
+  })
 }
@@ -64,0 +78,0 @@

lib/bionode-ncbi.js

@@ -590,3 +590,3 @@ // # bionode-ncbi
 // ## Fetch
-// Allows retrieval of records from NCBI databases. Takes the database name, and a search term,
+// Allows retrieval of records from NCBI databases. Takes the database name and a search term,
 // and returns the records from the database that match the search term. There are optional
@@ -596,3 +596,3 @@ // advanced parameters that allow you to define how many records to retrieve and extra options
 //
-// i.e it can return a subset of a genetic sequence of a requested species
+// It can return a subset of a genetic sequence of a requested species
 //
@@ -606,3 +606,3 @@ //      ncbi.fetch('sra', 'solenopsis_invicta')
 //
-// With advanced parameters for sequence databases(all are optional):
+// With advanced optional parameters:
 //
@@ -613,11 +613,15 @@ //      var opts = {
 //        strand: 1,
-//        complexity: 4
+//        complexity: 4,
+//        seq_start: 1,
+//        seq_stop: 50
 //      }
+//
 //      ncbi.fetch(opts)
-//      => { id: 'gi|557436392|gb|HE992975.1|HE992975 HE992975 Guillardia theta CCMP 327 Guillardia theta cDNA clone sg-p_014_h06, mRNA sequence',
-//          seq: 'GAAGGCGATTCCAATGGTGCGAGCGAGGCAGCGAACAGACGCAGCGGGGAGAG...
-//         }
+//      => { id: 'gi|557436392|gb|HE992975.1|HE992975:1-50 HE992975 Guillardia theta CCMP 327 Guillardia theta cDNA clone sg-p_014_h06, mRNA sequence',
+//           seq: 'GAAGGCGATTCCAATGGTGCGAGCGAGGCAGCGAACAGACGCAGCGGGGA' }
+//         { id: 'gi|557436391|gb|HE992974.1|HE992974:1-50 HE992974 Guillardia theta CCMP 327 Guillardia theta cDNA clone sg-p_014_h05, mRNA sequence',
+//           seq: 'GTCGCGGTTGGCATGGCTGAGGAGAATCCGATCCCTCGGCTAGACGCCTG' }
 //      => [...]
 // For some databases there are multiple return types. A default one will be chosen
-// automatically, however it is possible to specify this via the rettype option e.g:
+// automatically, however it is possible to specify this via the rettype option.
 //
@@ -631,3 +635,2 @@ // The NCBI website provides a list of databasese supported by efetch here:
 
-  // Default rettypes if user doesn't provide any
   var rettypes = {
@@ -634,0 +637,0 @@ bioproject: 'xml',

package.json

 {
   "name": "bionode-ncbi",
   "description": "Node.js module for working with the NCBI API (aka e-utils) using Streams.",
-  "version": "1.6.0",
+  "version": "1.6.1",
   "homepage": "http://github.com/bionode/bionode-ncbi",
@@ -17,4 +17,6 @@ "repository": {
     "async": "^0.9.0",
+    "bionode-fasta": "^0.5.3",
     "cheerio": "^0.19.0",
     "concat-stream": "~1.4.8",
+    "debug": "^2.1.3",
     "minimist": "^1.1.1",
@@ -25,8 +27,6 @@ "mkdirp": "^0.5.0",
     "request": "^2.55.0",
-    "split": "^0.3.3",
+    "split2": "^2.0.1",
     "through2": "^0.6.3",
     "tool-stream": "0.2.1",
-    "debug": "^2.1.3",
-    "xml2js": "^0.4.6",
-    "bionode-fasta": "^0.5.3"
+    "xml2js": "^0.4.6"
   },
@@ -33,0 +33,0 @@ "devDependencies": {

New alerts

License Policy Violation

License

This package is not allowed per your license policy. Review the package's license to ensure compliance.

Found 1 instance in 1 package

Fixed alerts

License Policy Violation

License

This package is not allowed per your license policy. Review the package's license to ensure compliance.

Found 1 instance in 1 package

Improved metrics

Lines of code

6831

increased by0.21%

Worsened metrics

Total package byte prevSize

1873404

decreased by-0.09%

Number of package files

30

decreased by-3.23%

Dependency changes

• + Addedsplit2@^2.0.1

• - Removedsplit@^0.3.3