Security News
Input Validation Vulnerabilities Dominate MITRE's 2024 CWE Top 25 List
MITRE's 2024 CWE Top 25 highlights critical software vulnerabilities like XSS, SQL Injection, and CSRF, reflecting shifts due to a refined ranking methodology.
Example applications can be found at github.com/wookoouk/blastjs-examples
npm install blastjs
If Blast+ is not installed you can run:
node util/getBlast.js
and the latest version of Blast+ will be downloaded and placed in the bin folder for you.
var blast = require('blastjs');
var type = 'nucl';
var fileIn = './test.fasta';
var outPath = './';
var name = 'example';
blast.makeDB(type, fileIn, outPath, name, function(err){
if(err){
console.error(err);
} else {
console.log('database created at', outPath);
}
});
var blast = require('blastjs');
blast.outputString(true); *optional*
var dbPath = './example';
var query = 'CTAATACCGAATAAGGTCAGTTAATTTGTTAATTGATGAAAGGAAGCCTT';
blast.blastN(dbPath, query, function (err, output) {
if(!err){
console.log(output);
}
});
.makeDB(type, fileIn, outPath, name, cb)
callback is passed (err, stdOut, stdErr, fileOut).
.blastN(db, query, cb)
callback is passed (err, output).
.blastP(db, query, cb)
callback is passed (err, output).
.blastX(db, query, cb)
callback is passed (err, output).
.tblastN(db, query, cb)
callback is passed (err, output).
.tblastX(db, query, cb)
callback is passed (err, output).
.outputString(boolean)
this toggles the output being in a string (true) or as JSON (false).
default is JSON.
FAQs
a blast+ wrapper
The npm package blastjs receives a total of 9 weekly downloads. As such, blastjs popularity was classified as not popular.
We found that blastjs demonstrated a not healthy version release cadence and project activity because the last version was released a year ago. It has 1 open source maintainer collaborating on the project.
Did you know?
Socket for GitHub automatically highlights issues in each pull request and monitors the health of all your open source dependencies. Discover the contents of your packages and block harmful activity before you install or update your dependencies.
Security News
MITRE's 2024 CWE Top 25 highlights critical software vulnerabilities like XSS, SQL Injection, and CSRF, reflecting shifts due to a refined ranking methodology.
Security News
In this segment of the Risky Business podcast, Feross Aboukhadijeh and Patrick Gray discuss the challenges of tracking malware discovered in open source softare.
Research
Security News
A threat actor's playbook for exploiting the npm ecosystem was exposed on the dark web, detailing how to build a blockchain-powered botnet.