central-dogma
Advanced tools
Comparing version 0.0.2 to 0.0.3
12
app.js
@@ -1,6 +0,10 @@ | ||
// const codon = require('./index.js'); | ||
// const nuc = require('./nucleotide.js'); | ||
const nuc = require('./index.js').nucleotide; | ||
const cod = require('./index.js').codon; | ||
// // const nucs = "TCCAGGTTTAACTGA"; | ||
// const nucs = "ATGAATGCTACACATGCGAACUGA"; | ||
const nucs = "ATGAATGCTACACATGCGAACTGA"; | ||
console.log(nuc.toValue(nucs)); | ||
const cods = nuc.toCodon(nucs); | ||
console.log(cod.toNumber(cods)); | ||
// const split = codon.splitToCodon(nucs); | ||
@@ -24,2 +28,2 @@ // console.log(split); | ||
// console.log(util.inspect(nuc)); | ||
// console.log(nuc.toComplement('ATCTTGGTAT')); | ||
// console.log(nuc.toComplement('ATCTTGGTAT')); |
@@ -21,3 +21,3 @@ 'use strict'; | ||
let newArray = []; | ||
for (codon in codArray) { | ||
for (const codon of codArray) { | ||
newArray.push(this.table.indexOf(codon)); | ||
@@ -30,3 +30,3 @@ } | ||
let newArray = []; | ||
for (codonNumber in codArray) { | ||
for (const codonNumber of codArray) { | ||
newArray.push(this.table[codonNumber]); | ||
@@ -48,2 +48,2 @@ } | ||
const cod = new Codon(); | ||
module.exports = cod; | ||
module.exports = cod; |
@@ -7,4 +7,4 @@ 'use strict'; | ||
constructor() { | ||
this.base = 'dna'; | ||
this.table = tables.dnaNucleotides; //new table goes here | ||
this.base = 'dna'; // dna || rna | ||
this.table = tables.dnaNucleotides; | ||
} | ||
@@ -11,0 +11,0 @@ |
{ | ||
"name": "central-dogma", | ||
"version": "0.0.2", | ||
"version": "0.0.3", | ||
"description": "used to manipulate and convert genetic strings from nucleotide to codon to protein", | ||
@@ -5,0 +5,0 @@ "main": "index.js", |
License Policy Violation
LicenseThis package is not allowed per your license policy. Review the package's license to ensure compliance.
Found 1 instance in 1 package
License Policy Violation
LicenseThis package is not allowed per your license policy. Review the package's license to ensure compliance.
Found 1 instance in 1 package
Major refactor
Supply chain riskPackage has recently undergone a major refactor. It may be unstable or indicate significant internal changes. Use caution when updating to versions that include significant changes.
Found 1 instance in 1 package
6568
211
0