Atropos is tool for specific, sensitive, and speedy trimming of NGS reads. It is a fork of the venerable Cutadapt read trimmer (https://github.com/marcelm/cutadapt, DOI:10.14806/ej.17.1.200), with the primary improvements being:
Atropos is available from pypi and can be installed using pip.
First install dependencies:
pip install Cython)Pip can be used to install atropos and optional dependencies, e.g.:
pip install atropos[tqdm,pysam,ngstream]
There is an Atropos recipe in Bioconda.
conda install -c bioconda atropos
A Docker image is available for Atropos in Docker Hub.
docker run jdidion/atropos <arguments>
Atropos is almost fully backward-compatible with cutadapt. If you currently use cutadapt, you can simply install Atropos and then substitute the executable name in your command line, with one key difference: you need to use options to specify input file names. For example:
atropos -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTTA -o trimmed.fq.gz -se reads.fq.gz
To take advantage of multi-threading, set the --threads option:
atropos --threads 8 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTTA -o trimmed.fq.gz -se reads.fq.gz
To take advantage of the new aligner (if you have paired-end reads with 3' adapters), set the --aligner option to 'insert':
atropos --aligner insert -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o trimmed.1.fq.gz -p trimmed.2.fq.gz \
-pe1 reads.1.fq.gz -pe2 reads.2.fq.gz
See the Documentation for more complete usage information.
Atropos is published in PeerJ.
Please cite as:
Didion JP, Martin M, Collins FS. (2017) Atropos: specific, sensitive, and speedy trimming of sequencing reads. PeerJ 5:e3720 https://doi.org/10.7717/peerj.3720
The results in the paper can be fully reproduced using the workflow defined in the paper directory.
The citation for the original Cutadapt paper is:
Marcel Martin. "Cutadapt removes adapter sequences from high-throughput sequencing reads." EMBnet.Journal, 17(1):10-12, May 2011. http://dx.doi.org/10.14806/ej.17.1.200
Simplification of command line options, perhaps by further splitting functionality up into different sub-commands, but also by more intelligent choices for default option values based on context.
Consider adding additional report formats
Add fuzzy matching: https://github.com/Daniel-Liu-c0deb0t/Java-Fuzzy-Search
Performance enhancements using
90% test coverage
Fuzz testing using AFL
While we consider the command-line interface to be stable, the internal code organization of Atropos is likely to change. At this time, we recommend to not directly interface with Atropos as a library (or to be prepared for your code to break). The internal code organization will be stabilized as of version 2.0, which is planned for sometime in 2017.
If you would like to suggest additional enhancements, you can submit issues and/or pull requests at our GitHub page.
FAQs
trim adapters from high-throughput sequencing reads
We found that atropos demonstrated a healthy version release cadence and project activity because the last version was released less than a year ago. It has 1 open source maintainer collaborating on the project.
Did you know?
Socket for GitHub automatically highlights issues in each pull request and monitors the health of all your open source dependencies. Discover the contents of your packages and block harmful activity before you install or update your dependencies.
Security News
PyPI confirms no security flaws were exploited in the Ultralytics supply chain attack and highlights improvements for safer package publishing.
Security News
Research
The Socket Research Team breaks down a malicious wrapper package that uses obfuscation to harvest credentials and exfiltrate sensitive data.
Research
Security News
Attackers used a malicious npm package typosquatting a popular ESLint plugin to steal sensitive data, execute commands, and exploit developer systems.