This tools are designed to deal with polyploid wheat. The first tool is to design KASP primers, making them as specific as possible.
gem install bio-polyploid-tools
You need to have in your $PATH the following programs:
The code was originally developed on ruby 2.1, 2.3 and 2.5. It may work on older version. However, it is only actively tested in currently supported ruby versions:
To run PolyMarker with the CSS wheat contigs, you need to unzip the reference file from ensembl.
polymarker.rb --contigs Triticum_aestivum.IWGSC2.25.dna.genome.fa --marker_list snp_list.csv --output output_folder
The snp_list file must follow the convention ID,Chromosome,SEQUENCE with the SNP inside the sequence in the format [A/T]. As a reference, look at test/data/short_primer_design_test.csv
If you want to use the web interface, visit the PolyMarker webservice at TGAC
The available command line arguments are:
Usage: polymarker.rb [options]
-c, --contigs FILE File with contigs to use as database
-m, --marker_list FILE File with the list of markers to search from
-g, --genomes_count INT Number of genomes (default 3, for hexaploid)
-s, --snp_list FILE File with the list of snps to search from, requires --reference to get the sequence using a position
-t, --mutant_list FILE File with the list of positions with mutation and the mutation line.
requires --reference to get the sequence using a position
-r, --reference FILE Fasta file with the sequence for the markers (to complement --snp_list)
-o, --output FOLDER Output folder
-e, --exonerate_model MODEL Model to be used in exonerate to search for the contigs
-i, --min_identity INT Minimum identity to consider a hit (default 90)
-a, --arm_selection arm_selection_embl|arm_selection_morex|arm_selection_first_two
Function to decide the chromome arm
-p, --primer_3_preferences FILE file with preferences to be sent to primer3
-v, --variation_free_region INT If present, avoid generating the common primer if there are homoeologous SNPs within the specified distance (not tested)
-x, --extract_found_contigs If present, save in a separate file the contigs with matches. Useful to debug.
-P, --primers_to_order If present, saves a file named primers_to_order which contains the KASP tails
The following formats are used to define the marker sequences:
If the option --marker_list FILE is used, the SNP and the flanking sequence is included in the file. The format contains 3 columns (the order is important):
[]) and the two alleles separated by a forward slash (/).BS00068396_51,2A,CGAAGCGATCCTACTACATTGCGTTCCTTTCCCACTCCCAGGTCCCCCTA[T/C]ATGCAGGATCTTGATTAGTCGTGTGAACAACTGAAATTTGAGCGCCACAA
If the flanking sequence is unknow, but the position on a reference is available, the option --snp_list can be used and the FASTA file with the reference sequence must be provided with the option --reference. This is to allow the use of a different assembly or set of contigs used for the discovery of the SNPs that are different to the reference given in the option --contigs. The format contains the following positional columns:
IWGSC_CSS_1AL_scaff_110,C,519,A,2A
This file format can be used with snp_positions_to_polymarker.rb to produce the input for the option--marker_list.
By default, the contigs and pseudomolecules from ensembl are used. However, it is possible to use a custom reference. To define the chromosome where each contig belongs the argument arm_selection is used. The defailt uses ids like: IWGSC_CSS_1AL_scaff_110, where the third field, separated by underscores is used. A simple way to add costum references is to rename the fasta file to follow that convention. Another way is to use the option --arm_selection arm_selection_first_two, where only the first two characters in each contig is used as identifier, useful when pseudomolecules are named after the chromosomes (ie: ">1A" in the fasta file).
If your contigs follow a different convention, in the file ChromosomeArm.rb it is possible to define new parsers, by adding at the begining, with the rest of the parsers a new lambda like:
@@arm_selection_functions[:embl] = lambda do | contig_name|
arr = contig_name.split('_')
ret = "U"
ret = arr[2][0,2] if arr.size >= 3
ret = "3B" if arr.size == 2 and arr[0] == "v443"
ret = arr[0][0,2] if arr.size == 1
return ret
end
The function should return a 2 character string, when the first is the chromosome number and the second the chromosome group. The symbol in the hash is the name to be used in the argument --arm_selection. If you want your parser to be added to the distribution, feel free to fork and make a pull request.
##Using blast
To use blast instead of exonerate, use the following command:
./bin/polymarker.rb --contigs test/data/BS00068396_51_contigs.fa --marker_list test/data/BS00068396_51_for_polymarker.fa --aligner blast -a arm_selection_first_two
There was some strange issue with the numbering, so bumped to 0.9.7
ChromosomeArm class.polymarker.rb now also prints the total number of hits found.priemr3.rb had a regression when adding the repetitive flag to the @values array. This lead to the wrong order of the columns in the output and possibly other secondary effects.--max_hits to polyamarker.rb to set a maximum number of bast hits to identify repetitive regions. This adds the column is_repetitve to the output. The mask is not calculated in repetitive regions and the primers are designed as non-specific.ruby tag_stats.rb -b HI.3206.006.Index_2.CS_125RNA_14d_Leaf8.sorted.bam -r /Users/ramirezr/Dropbox/JIC/expVIPMetadatas/RefSeq1.0/Genes/annotation/IWGSCv1.0_UTR_ALL.cdnas.fasta --tag 'NH'
ChromosomeArm.rb was fixed to conform the module assumptions for the package.lib/bio/PolyploidTools/ChromosomeArm.rb and the help message is updated automatically with the valid options.filter_best to replicate the original behaviour of selecting the best hit of each chromosome. Still useful for assemblies which still contain synthetic duplications.polymarker.rb added the flag --aligner blast|exonerate which lets you pick between blast or exonerate as the aligner. For blast the default is to have the database with the same name as the --contigs file. However, it is possible to use a different name vua the option --database.polymarker.rb Added to the flag --arm_selection the option scaffold, which now supports a scaffold specific primer.snp_position_to_polymarker Added the option --mutant_list to prepare files for PolyMarker from files with the following columns ID,Allele_1,position,Allele_1,target_chromosome.min_identity to set the minimum identity to consider a hit. The default is 90arm_selection_embl works with the mixture of contigs and pseudomoleculesgenomes_count for number of genomes, to be used on tetraploids, etc.FAQs
Unknown package
We found that bio-polymarker demonstrated a healthy version release cadence and project activity because the last version was released less than a year ago. It has 1 open source maintainer collaborating on the project.
Did you know?
Socket for GitHub automatically highlights issues in each pull request and monitors the health of all your open source dependencies. Discover the contents of your packages and block harmful activity before you install or update your dependencies.
Research
Four npm packages disguised as cryptographic tools steal developer credentials and send them to attacker-controlled Telegram infrastructure.
Security News
Ruby maintainers from Bundler and rbenv teams are building rv to bring Python uv's speed and unified tooling approach to Ruby development.
Security News
Following last week’s supply chain attack, Nx published findings on the GitHub Actions exploit and moved npm publishing to Trusted Publishers.